| UK Atheist & Science Online E-Zine Web Site: UK Atheist & Science E-Zine Discussion Forum: UK Atheist Message Board |
Creationists have long tried to disprove evolution using the Second Law of Thermodynamics. According to creationists, the Second Law of Thermodynamics says that everything should move to a state of higher "entropy" that they define as disorder, randomness, or chaos. Some creationists will even claim that evolution is totally unscientific because it contradicts this inviolate principle. However, if the oversimplified statement of the Second Law and the inaccurate definition of entropy they use were correct, then ice could not form. If the Second Law really said what creationists often say it does, no organism could grow given simple molecules as nutrients. Since thermodynamic entropy has a precise mathematical definition, defining it as simply "disorder" is bound to lead to incorrect conclusions. Misstating the Second Law leads to further errors.
Fortunately, the real Second Law of Thermodynamics in no way forbids local decreases in entropy as long as energy or matter is released to the surroundings to increase the net thermodynamic entropy of the Universe as a whole. For example, the energy released to the surroundings when ice forms "pays" for the decreased thermodynamic entropy of the ice. Those creationists who understand this aspect of the Second Law will still often refuse to give up the argument by bringing up the fact that adding heat to a squashed bug in a test tube will not cause the bug to re-assemble. They claim that adding energy to the bug guts is insufficient to get a local decrease in thermodynamic entropy in the form of bug resurrection. Surprise, surprise. From a thermodynamic standpoint, trying to form ice by heating water is equally absurd. However, they use the bug example to introduce an additional confusion -- the idea that intelligently programmed information is somehow a necessary condition for local decreases in thermodynamic entropy in biological systems. While it is true that local decreases in thermodynamic entropy require the proper conditions in addition to energy and/or matter exchanges with the surroundings, trying to invoke the need for information with the bug example is pointless. The Second Law of Thermodynamics says nothing about information being a necessary condition to get local decreases in thermodynamic entropy under any circumstances. Information theory is a completely separate realm from thermodynamics. The presence of intelligently programmed information is clearly not necessary for ice formation, for example. (Note: In thermodynamics, the technical term for something that exchanges energy and/or matter with the surroundings is an "open system." The energy and matter can go in or out in an open system. Animals are open systems because they take in energy in the form of food, radiate heat to the surrounding, breathe air, and produce wastes.)
In the end, the Second Law dictates that energy must be expended or released under the right conditions to put complex molecules together from simpler ones. Again, the Second Law says nothing about the need for information for this to occur. The Second Law also dictates that organisms that cease taking in energy and cease releasing wastes will, at best, be in stasis or, more likely, die and deteriorate because energy will become increasingly unavailable in such closed systems. As long as organisms eat and breathe, however, no aspect of their existence, including their evolution, will not violate the Second Law of Thermodynamics.
But what about this idea of information then? If the Second Law of Thermodynamics says nothing about information, obviously information theory has a lot to say about it. Does evolution, the idea that organisms can become more complex over succeeding generations, violate information theory? The short answer is "no." For the long answer, keep reading.
One of the reasons I kept using the perhaps annoying phrase "thermodynamic entropy" in the above discussion of the Second Law of Thermodynamics is that "entropy" shows up in information theory as well. However, "informational entropy" and "thermodynamic entropy" are not analogs. Temperature is an important aspect of thermodynamics, but there is nothing comparable to temperature in information theory (Yockey, 1992). Thus one should keep the concept of entropy in thermodynamics separate from the quantity known as "entropy" in information theory. About the only thing "thermodynamic entropy" and "informational entropy" have in common is that they both have a tendency to increase. (Although, as we have discussed, thermodynamic entropy can decrease locally under the right conditions.)
I will define informational entropy as the complexity of the message. the complexity of the message.
The one other thing informational entropy has in common with thermodynamic entropy is that informational entropy has a precise mathematical definition. Information itself also has a precise mathematical definition in information theory. Defining informational entropy and information content in words can lead to inaccuracies and incorrect conclusions, especially when a layman's understandings of the familiar terms information and meaning creep into the discussion. However, a reasonable definition of information content can be described as "a measure of the informational entropy of a message." I will define informational entropy as the complexity of the message. More precisely, the informational entropy or information content of a message can be described as the minimum number of instructions needed to describe the message with certainty. This definition approximates the idea of the Kolmogorov-Chaitin algorithmic entropy of a message (see Yockey, 1992).
Let's look at some examples.
The string of bits:
010101010101010101has low informational entropy. While you could say the string is 20 bits long and say that is its information content, the definition I will use says that the information content is low for the sequence because the sequence can be described as a simple instruction such as
01011010101000111001the complexity of the message is greater. The information content, as determined by the Kolmogorov-Chaitin algorithmic entropy is higher. In other words, it takes a longer instruction set to describe the bit sequence:
So what does this have to do with evolution? The more astute readers have probably already guessed. It turns out that random mutations can increase the complexity of a sequence and thus the information content in DNA. The repetitive sequence:
ATATATATATATATATATAThas low informational entropy and therefore low information content since it could be described by a single instruction:
ATATACATATATATATATAT
ATATACATATATATATATATATATACATATATATATATATThe instruction set for this 40 nucleotide sequence is larger than the instruction set for the 20 nucleotide sequence from which it was derived:
Since gene duplications are known to occur, the information content of a genome can increase as a result. Point mutations in the duplicated or original sequence have the potential of further increasing the complexity of the DNA sequence and thus its information content. Since information theory says that informational entropy tends to increase in a communication system that is prone to errors (Yockey, 1992), the increasing complexity of genomes over succeeding generations is inevitable. Thus the evolution of increasingly complex organisms seems an unavoidable consequence of information theory. This should be even more apparent when one realizes that it is not just structural genes that will become more complex. The genes that regulate body plans can also be duplicated and changed. Thus diversity of form is inevitable. One thing moderating this increasing complexity is natural selection. If a new, more complex genome is less fit, the inheritors of that new, more complex genome will die off and the organisms that inherit no mutations, fewer mutations, or different mutations will flourish. On the other hand, if the inheritors of the new, more complex genome are more fit in the old environment or in some new environment they chance upon, then they will prosper and the increased complexity will be passed on with the potential for further increases in subsequent generations. For a more technical and in depth discussion of informational entropy and evolution, I recommend Brooks (1984).
In case the implications of the above background in information theory are unclear, let's look at a two examples of mutations that produced increases in the information content of the DNA of organisms. I have chosen the examples I did because not only does information content as defined by information theory increase, but the increases in information content also resulted in a benefit for the inheritors of that increased information. Though some might consider the examples modest, they illustrate that information content and complexity can increase over generations and that benefits can result from this. This is all that is required to demonstrate the plausibility of evolution and to show that the creationist assertions that information contents can only decrease and that mutations cannot produce benefits or new information are false.
Example 1: Gene duplications in yeast leading to more fit progeny.
Brown et al. (1998) reported that a population of baker's yeast grown in a glucose limiting environment for a few hundred generations spontaneously produced mutant offspring. The mutant offspring were better able to take up the glucose from the low-glucose environment. The offspring were found to have duplications of two different sugar transport protein genes. Furthermore, there were more than three new genes formed from the control region of one of the sugar transport genes with the coding region of the second. Finally, the mutant offspring were able to out-compete individuals of the ancestral population in pair-wise competition experiments.
This really is a great example of an information-increasing mutation leading to progressive evolution. The new genes, combinations of a control region of one gene with the coding region of another, represent new information as determined by the Kolmogorov-Chaitin algorithmic entropy measure. The objection a creationist might raise that nothing "new" was created since both genes were already there and all you have is a combination of redundant information is irrelevant. It is indeed a new combination that did not exist before that increases the complexity of the yeast genome. The information content of the genome is increased according to the rigorous definitions of information theory. Creationists going all out in an incredulity argument would probably say "well, it's still a yeast" or "the yeast didn't sprout legs or anything really new." These fail for the reason the first objection fails. Creationists can still console themselves that the evolution of new features that even they could not deny takes much longer than a lifetime, so it probably will never be shown directly in a laboratory experiment that, for instance, an organism can go from "no legs" to "fully functional legs." However, this experiment demonstrates that complexity-increasing and information-increasing beneficial mutations do exist. The association of changes in the fossil record with such mutations is therefore a solid scientific inference rather than a religious leap of faith.
Example 2: Spontaneous tandem duplications in a pseudorevertants
This is really three related examples in one. Akanuma et al. (1996) were working with a bacteria that can normally grow at temperatures up to 85 degrees Celsius. They had a mutant that was thermally sensitive due to the deletion of 22 nucleotides in a gene coding for a protein involved in the synthesis of leucine, an amino acid. After growing the mutant strain under strong selective pressure (i.e. temperatures where the mutant could barely grow), the researches isolated three strains of that had improved growth at high temperature. The new strains differed from the wild-type bacteria from which the mutant was derived, hence the term "pseudorevertant." (A true revertant would have the same genotype as the wild-type organism). The three pseudorevertants all showed duplications of just part of the gene that added 6 to 21 nucleotides to the gene. The proteins coded for by these new mutant genes, which were longer and more complex in the informational entropy sense, also had improved catalytic activity in addition to improved thermal stability over the protein in the thermally-sensitive strain from which the pseudorevertants descended. Thus three different mutations, all increasing the information content of the genomes, produced more stable and efficient proteins.
Contrary to creationist contentions, evolution does not violate the Second Law of Thermodynamics or information theory. The evolution of organisms does not violate the Second Law of Thermodynamics any more than the growth of individual organisms violates the Second Law. The creationist contention that intelligent information in DNA somehow gets around the Second Law is erroneous. The only requirement for localized decreases in thermodynamic entropy that accompany protein synthesis or organism growth is the requirement for an open system. Organisms are open thermodynamic systems as long as they eat and breathe.
The real connection between entropy and evolution comes from looking at information theory. The kind of entropy that is important to evolution is informational entropy. Like thermodynamic entropy on a universal scale, informational entropy tends to increase over time. Since an increase in informational entropy means the complexity of a message increases, the message transmitted by DNA over generations increases in complexity. The organisms specified by the message will be more complex as a result. Evolution thus seems to be an inevitable consequence of the properties of information. Selection provides a filter that determines which of the more complex messages survive. Illustrating these trends are examples of organisms that, under specific selective pressures, experience partial or complete duplications of genes that lead to increased information content of genomes, enhanced fitness, and improved proteins. While these examples may not be as dramatic as creationists demand in asking for the "proof" of evolution that they don't really want in any case, the examples at least falsify the creationist contentions that information-increasing beneficial mutations do not exist.
| UK Atheist & Science Online E-Zine Web Site: UK Atheist & Science E-Zine Discussion Forum: UK Atheist Message Board |